مقدمه

میزان گوگرد در نفتهاي خام از ۱۰۰۰ – ۳۰۰۰ ppm متغیر در حال حاضر همه پالایشگاهها براي حذف گوگرد از

است و مهمترین ترکیب آلوده کننده نفتی محسوب میشود سوختهاي فسیلی متکی بر تکنیک پر هزینه گوگردزدایی

.(۹) احتراق مواد سوختنی حاصل از نفت خام مثل هیدروژنی (Hydrodesulfurization) می باشند، یک فرآیند

گازوئیل و بنزین موجب تولید و انتشار اکسیدهاي متفاوت کاتالیتیکی در فشار بالا ۱۵۰-۲۵۰) پوند بر اینچ مربع) و

گوگرد (SOX) و بیش از همه به صورت SO2 می شود که حرارت بالا ۲۰۰-۴۲۵) درجه سانتی گراد) که در آن از گاز

با ایجاد بارانهاي اسیدي موجب حل شدن مواد ساختمانی، هیدروژن براي احیاي گوگرد به سولفید هیدروژن استفاده

از بین رفتن جنگلها و سمی شدن دریاچه ها می گردد. می شود. حجم وسیعی از ترکیبات غیر آلی گوگردي و

همچنین افزایش غلظت گوگرد موجود در اتمسفر با همچنین ترکیبات آلی گوگردي ساده از طریق این فرآیند

تشکیل آئروسلهاي سولفات سبب بروز ناراحتیهاي تنفسی حذف می شوند، اما بیش از ۷۰ درصد از گوگرد موجود

و قلبی-عروقی در انسان می شود. از طرف دیگر، هر ساله در نفت خام ترکیبات آروماتیکی گوگردي بر پایه حلقه

قوانین و استانداردهاي موجود براي کنترل میزان گوگرد تیوفن می باشند که نسبت به عمل گوگردزدایی این روش

مجاز سوختهاي فسیلی سخت تر می شود. به عنوان مثال، مقاوم هستند .(۱۱) از این رو، توسعه روشهاي جدید مثل

سازمان حفاظت محیط زیست آمریکا (EPA) مرز میزان گوگردزدایی زیستی یا بیوکاتالیتیک به یکی از جاذبه هاي

گوگرد مجاز در سوختهاي دیزلی و گازوئیل را تا سال مهم بیوتکنولوژي در صنعت نفت تبدیل شده است.

۲۰۱۰ ، ۱۵ ppm تعیین کرد ۱) و .(۱۱

۵۷

۱۶S rRNA
مجله پژوهشهاي سلولی و مولکولی (مجله زیست شناسی ایران) جلد ۲۷، شماره ۱، ۱۳۹۳

روش گوگردزدایی زیستی به دلیل شرایط عملیاتی متعادل، هزینه هاي پایین و ویژگی مسیرهاي متابولیکی به عنوان یک روش مکمل براي فرآیند گوگردزدایی هیدروژنی در نظر گرفته می شود. از این رو تغییر زیستی ترکیبات تیوفنی توسط انواعی از سویههاي باکتریایی از قبیل رودوکوکوس، گوردونیا، میکوباکتریوم، پانیباسیلوس، سودوموناس و

غیره مورد مطالعه قرار گرفته است ۸)، ۹ و .(۱۱

سودوموناس استوتزري یک باکتري با قابلیتهاي ژنتیکی و فیزیولوژیکی بالا، در تجزیه بسیاري از هیدروکربنهاي آلیفاتیک و آروماتیک نقش دارد .(۷) در این تحقیق به بررسی فعالیت گوگردزدایی یک سویه باکتریایی بر روي تیوفن پرداخته شده است که به مقدار فراوانی در گازوئیل وجود دارد. در فرآیند گوگردزدایی هیدروژنی، مولکول تیوفن از طریق سیس- یا ترانس- -۱ بوتن به بوتان و گاز سولفید هیدروژن تبدیل می شود .(۳) تا به امروز، یک مکانیسمی که گوگرد را از تیوفن غیر استخلاف شده به طور انتخابی جدا کند مانند مسیر ۴S براي دي بنزوتیوفن شناسایی نشده است .(۱۰)

مواد و روشها

مواد شیمیایی: تیوفن از شرکت مرك آلمان با درجه خلوص بالا خریداري شد. کیت استخراج DNPTM ) DNA (Kit و کیت واکنش PCR از شرکت داخلی سیناژن تهیه شد. پرایمرهاي مورد استفاده براي تعیین توالی از شرکت تگ کپنهاگ دانمارك خریداري شد.

مشخصات باکتري: باکتريSEE-1 که از خاك آلوده به

MTBE جداسازي شده بود مورد استفاده قرار گرفت. این باکتري گرم منفی با تست کاتالاز و اکسیداز مثبت، فاقد اسپور و باسیل می باشد که کلنیهاي این باکتري بر روي محیط کشت جامد آگار مغذي (نوترینت آگار) به رنگ زرد رنگ پریده، گرد و صاف دیده می شوند. کلنیهاي تازه جداسازي شده این باکتري خشن و خشک با یک ظاهر

خاص چروکیده به همراه لبههاي برآمده بود که پس از برداشتن، محل اثر برداشتن کلنی باقی میماند. پس از پاساژهاي مکرر در محیطهاي کشت آزمایشگاهی کلنیها به حالت صاف و گرد تبدیل شدند (شکل .(۱

تعیین ترادف ژن : به منظور شناسایی

مولکولی باکتري مورد نظر، DNA ژنومی آن طبق دستورالعمل کیت مورد استفاده استخراج شد، سپس واکنش PCR با دو پرایمر رفت RW01 و برگشت DG74

انجام شد که توالی پرایمرها به صورت زیر است: پرایمر رفت (۵’AACTGGAGGAAGGTGGGGAT3′) RW01

و پرایمر برگشت DG74

.(۵’AGGAGGTGATCCAACCGCA3′) محصول به دست آمده توسط این دو پرایمر حاوي ۳۷۰ bp بود. برنامه
PCR به صورت یک سیکل دناتوراسیون اولیه با دماي ۹۵

درجه سانتی گراد به مدت ۵ دقیقه، ۳۰ سیکل با دماي ۹۴

درجه سانتی گراد به مدت ۴۵ ثانیه، ۵۴ درجه سانتی گراد به مدت ۳۰ ثانیه، ۷۲ درجه سانتی گراد به مدت ۴۵ ثانیه و یک سیکل نهایی ۷۲ درجه سانتی گراد به مدت ۵ دقیقه تنظیم شد.

محصول PCR پس از مشاهده بر روي ژل ۱ درصد آگارز، جهت تعیین توالی به شرکت ماکروژن در کره جنوبی فرستاده شد. توالی به دست آمده با دیگر توالیهاي شناخته شده موجود در بانک ژنی مرکز NCBI با استفاده از برنامه BLASTn مقایسه گردید .(۵)

تهیه سلولهاي فعال بدون رشد: کشت اولیه باکتري SEE-1 در ارلن حاوي ۵۰ میلی لیتر از محیط کشت لوریا برتانی

(LB) در دماي ۳۰ درجه سانتی گراد انجام شد. پس از آنکه باکتري به انتهاي فاز لگاریتمی رشد خود نزدیک گردید، سلولهاي باکتري توسط سانتریفیوژ (دور ۱۸۰۰ g

به مدت ۱۰ دقیقه) ته نشین شدند. رشد سلولی توسط دستگاه اسپکتروفتومتر (مدل SECOMAM XS 5 ساخت فرانسه) در طول موج ۶۰۰ نانومتر اندازه گیري شد. سپس

۵۸

مجله پژوهشهاي سلولی و مولکولی (مجله زیست شناسی ایران) جلد ۲۷، شماره ۱، ۱۳۹۳

سلولها توسط محلول ۰/۹ درصد کلرور سدیم دو بار شستشو داده شدند و مجدداً همین محلول اضافه شد تا سوسپانسیون سلولی تشکیل گردد که چگالی سلولی آن در طول موج ۶۰۰ نانومتر به ۳۰ برسد .(۶) (OD600 = 30)

سنجش تیوفن در فاز آبی با روش اسپکتروفتومتر : UV

مقدار ۰/۲ میلی لیتر از سوسپانسیون سلولی تهیه شده به ۵

میلی لیتر محلول ۰/۹ درصد کلرور سدیم حاوي ۱۲/۴

میلی مولار تیوفن در لوله درب دار اضافه گردید و بر روي شیکر ۱۲۰) دور در دقیقه) با دماي ۳۰ درجه سانتی گراد به مدت ۱۵ ساعت انتقال داده شد. به منظور اندازه گیري میزان گوگردزدایی، رقت هاي متفاوت تیوفن در محلول

۰/۹ درصد کلرور سدیم از غلظت ۱۲/۴ میلی مولار تیوفن آماده گردید و حداکثر جذب تیوفن در طول موج ۲۳۰

نانومتر توسط دستگاه اسپکتروفتومتر UV (مدل -۱۶۰A

UV شرکت شیمادزو ژاپن) اندازه گیري شد. معادله منحنی استاندارد تیوفن به صورت y = 3/437 x – ۰/۰۲۱، ۰/۹۹۸ R2 = با استفاده از نرم افزار Excel به دست آمد : y)

جذب، : x مقدار تیوفن بر حسب میلی مولار).

سنجش تیوفن در فاز گازي با روش کروماتوگرافی

گازي : (GC) مقدار ۰/۵ میلی لیتر از سوسپانسیون سلولی تهیه شده به ۵ میلی لیتر محلول %۰/۹ کلرور سدیم حاوي

۶۲ میلی مولار تیوفن در شیشه درب دار با درب پلاستیکی اضافه گردید. پس از ۲۰ ساعت گرماگذاري در دماي ۳۰

درجه سانتی گراد بر روي شیکر ۱۲۰) دور در دقیقه)، با سوراخ کردن درب پلاستیکی شیشهها توسط سرنگ ۱

میلی لیتري، میزان ۲۰۰ میکرولیتر از هواي بالاي سطح مایع جهت شناسایی تیوفن به دستگاه کروماتوگرافی گازي

(مدل Agilent 6890N ساخت آمریکا) تزریق شد. ستون مورد استفاده HP-5 با طول ۳۰ متر، قطر داخلی ۰/۳۲ میلی متر و ضخامت لایه ۰/۲۵ میکرومتر بود. برنامه دمایی نیز بدین ترتیب بود: دماي آون ۳۵ درجه سانتی گراد و توقف در این دما ۷ دقیقه، افزایش دما تا ۷۵ درجه سانتی گراد با

شیب دمایی ۱۰ درجه سانتی گراد در هر دقیقه و در نهایت افزایش دما تا ۱۰۰ درجه سانتی گراد و توقف در این دما به مدت ۲ دقیقه می باشد. دماي محل تزریق و آشکارساز،
۲۰۰ و ۲۵۰ درجه سانتی گراد بود. از گاز هلیوم با سرعت جریان ۲ میلی لیتر در دقیقه به عنوان گاز حامل استفاده شد. درصد تیوفن با استفاده از مساحت پیک حاصل از آشکارساز یونیزاسیون شعله اي (FID) محاسبه گردید

.(۱۲)

تاثیر عصاره آنزیمی فاقد سلول در حذف تیوفن: به

منظور تهیه عصاره آنزیمی فاقد سلول، سلولهاي رشد یافته در ۲۵۰ میلی لیتر محیط لوریا برتانی از انتهاي فاز لگاریتمی توسط سانتریفیوژ (دور ۱۸۰۰ g به مدت ۱۰

دقیقه) جمع آوري شدند، سلولها توسط بافر فسفات استریل (pH = 7/1) دو بار شستشو داده شدند و مجدداً در

۵ میلی لیتر بافر فسفات حاوي ۱۲/۴ میلی مولار تیوفن به منظور القاي آنزیمهاي درگیر در تجزیه آن سوسپانسیون گردیدند. پس از ۲ ساعت، سلولها با بافر فسفات شستشو داده شدند و مجدداً در همین بافر تا رسیدن OD600 به ۲۰
به حالت سوسپانسیون تبدیل شدند. در مرحله بعد، سلولهاي باکتري با استفاده از دستگاه اولتراسونیک

dr.hielscher GmbH) مدل VP 200H ساخت آلمان) ۱۰

بار بر روي یخ (هر بار ۱ دقیقه سونیکیت و ۳۰ ثانیه استراحت) شکسته شدند و عصاره آنزیمی پس از جداسازي اجساد خرد شده سلولی با سانتریفیوژ (دور g
10000 در ۴ درجه سانتی گراد به مدت ۱۰ دقیقه) به دست آمد .(۴) مقدار پروتئین عصاره آنزیمی حاصل با استفاده از معرف برادفورد و منحنی استاندارد پروتئین،
۳۰/۳ میکروگرم در میلی لیتر محاسبه گردید ۱ .(۲) میلی لیتر از عصاره آنزیمی به ۵ میلی لیتر محلول ۰/۹ درصد کلرور سدیم حاوي ۱۲/۴ میلی مولار تیوفن اضافه گردید و پس از گذشت ۹۰ دقیقه، جذب UV تیوفن خوانده شد و با نمونه حاوي همین مقدار تیوفن بدون عصاره آنزیمی به عنوان کنترل مقایسه گردید.

۵۹

مجله پژوهشهاي سلولی و مولکولی (مجله زیست شناسی ایران) جلد ۲۷، شماره ۱، ۱۳۹۳

انجام عمل گوگردزدایی زیستی سلولهاي فعال بدون

رشد در یک محیط نفتی: جمع آوري سلولها از انتهاي فاز لگاریتمی و آماده سازي سوسپانسیون سلولی با OD600

برابر ۲۰ مطابق قسمت قبل انجام شد. میزان ۳ میلی لیتر از این سوسپانسیون سلولی به یک ارلن شامل ۱۰۰ میلی لیتر محلول بافر فسفات (pH = 7/1) و ۲۵ میلی لیتر نفت خام به دست آمده از پالایشگاه اصفهان اضافه گردید. یک ارلن حاوي همین مقادیر از بافر فسفات و نفت خام بدون اضافه کردن باکتري به عنوان کنترل در نظر گرفته شد. بعد از ۲۴ ساعت گرماگذاري در دماي ۳۰ درجه سانتی گراد

بر روي شیکر ۱۶۰) دور در دقیقه)، سلولها با سانتریفیوژ

۶۰۰۰ g) به مدت ۱۰ دقیقه) جمع آوري و میزان سولفات مایع رویی بر حسب میلی گرم در لیتر با روش کدورت سنجی در طول موج ۴۲۰ نانومتر مورد بررسی قرار گرفت

.(۱۳) معادله منحنی استاندارد سولفات سدیم به منظور اندازه گیري میزان سولفات به صورت ۰/۱۶۵ x + 0/475 y =، R2 = 0/989 با استفاده از نرم افزار Excel به دست آمد : y) جذب، : x غلظت سولفات بر حسب میلی گرم در

لیتر).

شکل -۱ تصویر کلنی باکتري SEE-1 بر روي محیط آگار مغذي (تصویر چپ مربوط به کلنیهاي خشن با ظاهر چروکیده خاص، تصویر راست مربوط به کلنیهاي صاف و گرد پس از پاساژهاي مکرر) و سلولهاي آن در زیر میکروسکوپ

۶۰

مجله پژوهشهاي سلولی و مولکولی (مجله زیست شناسی ایران) جلد ۲۷، شماره ۱، ۱۳۹۳

نتایج و بحث

شناسایی سویه مورد استفاده: نتایج به دست آمده نشان

داد باکتري مورد استفاده در این تحقیق بیشترین شباهت

(>99%) را با گونه سودوموناس استوتزري (شماره

دسترسی: (Af063219,1 نشان میدهد. این باکتري پس از شناسایی، در بانک ژنی NCBI با شماره دسترسی
HQ438282 به ثبت رسید. تصویر کلنیهاي مربوط به این سویه در شکل (۱) نشان داده شده است.

شکل -۲ جذب UV تیوفن در طول موج ۲۳۰ نانومتر توسط سلولهاي فعال بدون رشد باکتري پس از ۱۵ ساعت گرماگذاري در دماي ۳۰ درجه سانتی گراد: (A نمونه کنترل بدون باکتري با رقت (B 1 ⁄۵۰ نمونه حاوي باکتري با رقت ۱⁄۲، (C نمونه حاوي باکتري با رقت .۱⁄۱۰ (محور افقی:

طول موج بر حسب نانومتر، محور عمودي: میزان جذب (UV

۶۱

مجله پژوهشهاي سلولی و مولکولی (مجله زیست شناسی ایران) جلد ۲۷، شماره ۱، ۱۳۹۳

جدول -۱ درصد کاهش تیوفن با غلظت اولیه ۱۲/۴ میلی مولار توسط سلولهاي فعال بدون رشد (آزمایش براي هر نمونه با سه تکرار صورت گرفت که میانگین جذب آنها آورده شده است)
شماره رقت جذب در ۲۳۰ نانومتر مقدار تیوفن باقیمانده درصد کاهش تیوفن
(میلی مولار) (%)

شکل ۲ قسمت B 1⁄۲ ۰/۵۴۷ ۰/۳۳ % ۹۷/۴

شکل ۲ قسمت C 1⁄۱۰ ۰/۱۱۶ ۰/۳۹ % ۹۶/۸

نمونه کنترل (قسمت (A 1⁄۵۰ ۰/۸۰۷ ۱۲/۰۴ % ۲/۹۱

ارزیابی فعالیت باکتري بر روي تیوفن : از نمونههاي حاوي سلولهاي فعال بدون رشد این باکتري پس از رسوب دادن توده سلولی، رقتهاي ۱⁄۲ و ۱⁄۱۰ از مایع رویی حاوي تیوفن آماده شد و از میزان جذب UV به دست آمده در طول موج ۲۳۰ نانومتر (شکل (۲ و استفاده از معادله خط منحنی استاندارد تیوفن ، مقدار تیوفن به صورت جدول (۱) محاسبه گردید. کاهش جزئی درصد تیوفن در نمونه کنترل به دلیل ماهیت فرار بودن آن میباشد.

همچنین نمودارهاي گاز کروماتوگرام حاصل از عملکرد گوگردزدایی باکتري مورد استفاده بر روي تیوفن و همچنین نمونه کنترل حاوي تیوفن بدون باکتري در شکل

(۳) نشان داده شده است. کروماتوگرام مربوط به نمونه

کنترل دو پیک اصلی را نشان میدهد، پیک در زمان بازداري ۱/۹ دقیقه که با توجه به کاهش این پیک در نمونه حاوي باکتري به عنوان پیک معرف تیوفن در نظر گرفته می شود. همچنین در نمونه کنترل پیک دومی در زمان بازداري ۳/۲ دقیقه مشاهده گردید که مربوط به وجود ناخالصی به همراه تیوفن میباشد. با توجه به اطلاعات مربوط به سطح زیر منحنی و ارتفاع پیک تیوفن در زمان بازداري ۱/۹ دقیقه، درصد کاهش تیوفن توسط این باکتري

۹۳/۸۲ درصد به دست آمد.

شکل -۳ نمودارهاي GC نمونه کنترل و نمونه حاوي باکتري مورد مطالعه پس از ۲۰ ساعت گرماگذاري در دماي ۳۰ درجه سانتی گراد: (A نمونه کنترل حاوي تیوفن بدون باکتري، (B نمونه حاوي باکتري. (محور افقی: زمان بازداري بر حسب دقیقه، محور عمودي: پیکوآمپر بر ثانیه)

۶۲

مجله پژوهشهاي سلولی و مولکولی (مجله زیست شناسی ایران) جلد ۲۷، شماره ۱، ۱۳۹۳

استفاده از کاتالیزور آنزیمی براي حذف تیوفن: با تهیه رقت ۱⁄۵۰، جذب UV تیوفن نمونه حاوي ۱ میلی لیتر از عصاره آنزیمی باکتري و نمونه حاوي تیوفن بدون عصاره آنزیمی به عنوان کنترل به دست آمد (شکل .(۴ کاهش جذب UV در طول موج ۲۳۰ نانومتر توسط عصاره

آنزیمی استخراج شده از باکتري نسبت به نمونه کنترل نشان دهنده تجزیه آنزیمی تیوفن می باشد. با توجه به اطلاعات مربوط به جذب UV در طول موج ۲۳۰ نانومتر، درصد کاهش تیوفن توسط عصاره آنزیمی این باکتري

۲۸/۴۹ درصد به دست آمد.