شمال غرب آسیا منطقهاي است که تنوع گسترده موفولوژیکی زنبور عسل در آنجا دیده میشود .(۱۷)
جدایی جغرافیایی میتواند منجر به تمایز ژنتیکی جمعیتها به واسطه انتخاب محلی((Local selection و رانش ژنی

(Gene flow) شود و در نهایت باعث ایجاد گروههایی شود که نژاد نامیده میشوند .(۶) از مدتها قبل براي زنبور عسل فقط چهار گونه شناخته شده بود. در حالی که طبق مطالعه فیلوژنتیکی، حداقل شش گونه از جنس آپیس

(Apis) در دنیا انتشار دارد .(۵) زنبورعسل حشرهاي بسیار سازش یافته با اکوسیستمهاي متغیر در گستره آفریقا، اروپا

و قسمتهاي مرکزي و غرب آسیا میباشد. در حدود ۲۶

زیر گونه و اکوتیپهاي (موجود سازش یافته با یک زیستگاه

خاص) متعدد گونه بر اساس رفتار،

صفات ظاهري و شواهد مولکولی معرفی شده است. برخی نژادها منطقه جغرافیایی وسیع و برخی دیگر مناطق کوچکی را اشغال میکنند .(۱۸) بعضی از محققین از تفاوتهایی همچون واکنش به سرما، ابتلا به بیماري، ریتمهاي (رقصهاي) حین برقراري ارتباط و ویژگیهاي یادگیري به عنوان عامل تعیین کننده تمایز بین گونهها استفاده کردهاند .(۱۹)

۴۶۲

مجله پژوهشهاي سلولی و مولکولی (مجله زیست شناسی ایران) جلد ۲۶، شماره ۴، ۱۳۹۲

در زنبورها، از آغازگرهاي ریزماهواره براي اولین بار در Apis melifera و Bombus terrestris استفاده شد و سپس براي سه نوع زنبور عسل بدون نیش استفاده گردید
.(۸) ریزماهوارهها توالیهاي ساده و تکراري کوتاهی((SSR

هستند که اگر طول آنها به حد کافی بلند و غیر منقطع باشد، به دلیل چند شکل بودن به عنوان نشانگرهاي ژنتیکی مناسبی به کار میروند .(۴) شمار زیادي از میکروستلایت ها براي ژنوم انسانی، حیوانات مدل و تعدادي از گیاهان زراعی توسعه پیدا کرده است. در زنبوران عسل نقشه پیوستگی ژنی براي گونه آپیس و چندین زنبور دیگر تهیه شده است .(۱۸) فرانک و همکاران در سال ۲۰۰۱ در بررسی زنبوران عسل آفریقا با استفاده از نشانگرهاي ریزماهواره و میتوکندریایی، نشان دادند که جایگاههاي ریزماهواره به طور گسترده در جمعیتهاي آفریقایی نسبت به اروپایی چندشکلی زیادي را نشان میدهد و این خود تفسیري بر اندازه بزرگ جمعیتها در آفریقا است .(۱۰) با مطالعه ۷ جایگاه ریز ماهواره در ساختار ژنتیکی زنبوران عسل مشخص شد که هیچ کدام از جایگاهها از تعادل هاردي– واینبرگ انحراف ندارند .(۹)

استان اردبیل از لحاظ تولید عسل و پرورش زنبور عسل در ایران از اهمیت قابل توجهی برخوردار است. این مطالعه به منظور بررسی تنوع ژنتیکی بین جمعیتهاي زنبورعسل موجود در برخی مناطق استان اردبیل با استفاده از نشانگر هاي مورفولوژیکی و مولکولی (ریز ماهواره) انجام شد.

مواد و روشها

-۱ مطالعات مورفولوژیک: براي انجام مطالعات مورفولوژیک، از کندوهاي مربوط به زنبورداریهاي برخی شهرستانهاي استان اردبیل (اردبیل، نمین، نیر، هیر، مشکین-

شهر، سرعین و گرمی) که داراي بیش از صد کلنی بودند و حدود ۶ سال سابقه زنبورداري داشتند، نمونه برداري به عمل آمد. در هر منطقه، نمونه برداري به طور تصادفی از

۳-۱ کلنی و در طی ماههاي تیر، مرداد و شهریور سال

۱۳۸۵ انجام شد. از هر کلنی در حدود ۱۵ زنبور عسل کارگر انتخاب گردید. براي نمونه برداري از ظروف پلاستیکی دهان گشاد استفاده شد و زنبورها با احتیاط از داخل هر کندو و از روي شانهاي زنبور عسل در داخل بطریهاي پلاستیکی قرار داده شدند. صفات ظاهري روي ۶

زنبور کارگر از هر کلنی اندازهگیري شد و در مورد اعضایی که به طور قرینه در بدن زنبور عسل وجود دارند، همیشه عضو سمت راست براي اندازهگیري انتخاب شد. از بین حدود ۴۰ صفت ظاهري که براي متمایز ساختن نژادهاي زنبور عسل دنیا استفاده میشود، ۱۱ صفت ظاهري کمی

(جدول (۳ و سه صفت کیفی ( شکل تومنتوم، وضعیت زاویه دیسکوئیدال و رنگ نیم حلقههاي پشتی و شکمی ناحیه شکم) انتخاب شد. براي بررسی ویژگیهاي مربوط به بال جلو، پس از جدا کردن بال سمت راست مدتی آن را در محلول الکل ۷۰ درصد قرار داده و سپس بالها به ترتیب روي اسلایدهاي دو جداره چیده شدند تا پس از تبخیر الکل به اسلایدها بچسبند و اندازه گیري روي آنها انجام شود. دادههاي حاصل از اندازه گیري طول و زاویه رگبالها و شاخص کوبیتال در شناسنامه هر کلنی ثبت گردید. براي اندازهگیري طول خرطوم، طول و عرض بال جلویی، طول پاي عقبی و سلول رادیال از استریو میکروسکوپ مجهز به عدسی مدرج استفاده شد. کلیه اندازهگیریها با استفاده از روش بین المللی روتنر انجام گرفت .(۱۶)

-۲ استخراج : DNA براي انجام مطالعات مولکولی، استخراج DNA با استفاده از روش نمکی بهینه ( Salting (out method با اندکی تغییرات انجام شد .(۷) پس از جدا کردن قسمت سینه حشره و شستشوي آن با آب مقطر، نمونهها به لولههاي میکروتیوب منتقل و با استفاده از لوله پلاستیکی خرد شدند. بافرهاي استخراج CTAB وTNE به ترتیب به مقدار۱۲۰µl و۵۰۰µl به میکروتیوبها اضافه و مخلوط ورتکس گردید. آنزیم پروتئیناز K به مقدار ۸

واحد در داخل یخ به نمونهها اضافه و در حمام آب ۶۰

درجه سانتی گراد به مدت ۱۲ ساعت اینکوبه شدند.

۴۶۳

مجله پژوهشهاي سلولی و مولکولی (مجله زیست شناسی ایران) جلد ۲۶، شماره ۴، ۱۳۹۲

مخلوط حاصل در دو نوبت با محلول فنل کلروفرم سانتریفیوژ ( ۱۰۰۰۰×g/min) و محلول رویی دور ریخته شد. براي رسوب DNA، ۲/۵ برابر اتانل سرد ۱۰۰ درصد اضافه و پس از سانتریفیوژ و دور ریختن محلول رویی، رسوب حاصل با اتانل ۷۰ درصد شستشو و در هواي آزاد خشک گردید. رسوب خشک شده در آب دیونیزه حل و پس از ارزیابی کمی و کیفی با روش اسپکتروفتومتري و الکتروفورز بر روي ژل آگارز ۰/۸ درصد، در فریزر نگهداري گردید.

-۳ بررسی نشانگرهاي ریزماهواره: در این تحقیق از ۲

جایگاه ریز ماهوارهاي AM2 وA88 استفاده شد (جدول

.(۱ آغازگرهاي AM2f وAM2B با استفاده از نرم افزار

Oligo 0.6 و الگو قرار دادن توالی ثبت شده به شماره

AJ509247طراحی گردید و آغازگرهاي A88f و A88b بر اساس گزارشات قبلی ساخته شد(.(۵ واکنش PCR در حجم ۲۵ میکرولیتر شامل: ۲ واحد آنزیم Taq پلیمراز، ۱/۲

میلیمول dNTP، ۱/۵ میلیمول MgCl2 ، ۴ میلیمول از هر آغازگر و ۳۰ نانوگرم DNA صورت گرفت. مراحـل واکنش PCR شامل ۹۴ درجه سانتی گراد به مدت ۳ دقیقه در یک چرخه، ۹۴ درجه سانتی گراد به مدت ۱ دقیقه، ۵۴

درجه سانتی گراد به مدت ۳۰ ثانیه و ۷۲ درجه سانتی گراد به مدت ۱ دقیقه در ۳۴ چرخه و ۷۲ درجه سانتی گراد به مدت ۵ دقیقه جهت تکمیل نهایی تکثیر بود. محصول

PCR در سطح ژل آگارز ۲ درصد و با رنگ آمیزي اتیدیوم بروماید مورد بررسی اولیه قرار گرفت و جهت ارزیابی و سنجش دقیق آللهاي ریز ماهواره از الکتروفورز محصول
PCR بر روي ژل پلی آکریلامید ۱۲ درصد استفاده شد.

-۴ تجزیه و تحلیل آماري: پس از اندازهگیري صفات ظاهري، تجزیه واریانس و محاسبه میانگین، معیار اشتباه صفات اندازه گیري شده با استفاده از نرم افزار SPSS14

انجام شد .(۱۲) براي بررسی میزان دوري و نزدیکی جمعیتها و نژادهاي مورد مطالعه از روش تجزیه خوشهاي

با روش حداقل واریانس وارد (Ward) استفاده شد .(۱۲)

تجزیه تنوع ژنتیکی جمعیتها در جایگاههاي مورد نظر شامل تعداد آللها در هر لوکوس، تعداد ژنوتیپها و میزان تنوع در هر جمعیت و لوکوس، فراوانی آللی، هتروزیگوسیتی مورد انتظار و مشاهده شده و تعادل هاردي واینبرگ با استفاده از نرم افزار Popgen3.2 انجام گرفت

.(۱۳) گروهبندي نژادها براساس دادههاي مولکولی با استفاده از تجزیه خوشهاي به روش UPGMA انجام شد.

نتایج

براي شناسایی نژادهاي مختلف زنبورعسل با استفاده از کلیدهاي شناسایی روتنر((۱۶، از یازده صفت مختلف استفاده شد. پس از اندازه گیري صفات مذکور در نمونههاي زنبورعسل و مقایسه آنها با کلید شناسایی در مجموع چهار نژاد در مناطق مختلف استان اردبیل شناسایی شد. نژادهاي شناسایی شده عبارت بودند از: نژاد ایرانی، نژاد ایتالیایی، هیبرید میدنایت، هیبرید استارلاین. میانگین این صفات در چهار نژاد در جدول ۳ مشاهده میشود.

تجزیه واریانس صفات کمی در نژادهاي زنبور عسل نشان داد که بین نژادها در صفات کمی کوبیتال A، کوبیتالB،

طول خرطوم، طول پاي عقبی و زاویه A4 اختلاف معنی-

داري وجود دارد ( جدول .(۲ به غیر از صفات مورد استفاده در شناسایی، صفات مورفولوژیکی مختلفی (جدول

(۴ در این نژادها اندازهگیري شد. میانگین و معیار اشتباه صفات اندازهگیري شده در جدول ۴ نشان داده شده است.

براي مقایسه نژاد ایرانی با سایر نژادهاي وارد شده به استان اردبیل، این نژادها بر اساس صفات مورفولوژیکی و با استفاده از روش تجزیه خوشهاي گروهبندي شدند.

گروه بندي جمعیتها با استفاده از صفات کیفی از قبیل رنگ نیم حلقههاي پشتی، شکل تومنتوم و وضعیت زاویه دیسکوئیدال، صفات کمی از قبیل شاخص کوبیتال و طول خرطوم، طول و زاویه رگبالها و ترکیب صفات مذکور

۴۶۴

مجله پژوهشهاي سلولی و مولکولی (مجله زیست شناسی ایران) جلد ۲۶، شماره ۴، ۱۳۹۲

انجام گرفت. نتیجه گروهبندي حاصل از صفات کیفی در تفکیک شدند و این مسئله نشان میدهد که صفات کیفی
شکل ۱ دیده میشود. در این گروهبندي جمعیتهاي نژاد در تمایز جمعیتهاي مورد مطالعه بهتر عمل کرده است.
ایرانی، ایتالیایی، استارلاین و میدنایت به خوبی از هم

جدول -۱ مشخصات آغازگرهاي مورد استفاده براي تکثیر جایگاههاي ریزماهواره در زنبور عسل
نام آغازگر توالی ریزماهواره لوکوس مرجع

AM2f GGAGCGGAGAAGACTTCACC AJ509247 این تحقیق
AM2b GATCGGGAACCGTAGAAACC AJ509247 این تحقیق
A88f CGAATTAACCGATTTGTCG AJ509283 استوپ و همکاران (۱۹۹۵)
A88b GATCGCAATTATTGAAGGAG AJ509283 استوپ و همکاران (۱۹۹۵)

جدول-۲ نتایج حاصل ازتجزیه واریانس یکطرفه براي صفات کمی مورد مطالعه

منابع درجه میانگین
تغییر آزادي مربعات
(df) (MS)
شاخص کوبیتال کوبیتال طول طول بال عرض بال طول پاي زاویه زاویه زاویه طول
کوبیتال a b خرطوم جلویی جلویی عقبی G18 D7 A4 سلول
رادیال
بین ۳ ۰/۲۲ns 0/19* 0/026* 4/39** 0/045 ns 0/045 ns 0/704** 7/99 ns 7/01 ns 30/76** 0/003 ns
گروه
داخل ۱۷۶ ۰/۱۱۰ ۰/۰۰۵ ۰/۰۰۵ ۰/۰۵۸ ۰/۰۷۴ ۰/۰۰۸ ۰/۱۰۳ ۳/۸۲ ۳/۸۲ ۴/۵۶ ۰/۰۰۷
گروه

ns، * و ** به ترتیب غیر معنیدار، معنیدار در سطح ۵ و ۱ درصد

شکل -۱ نمودار درختی حاصل از تجزیه خوشهاي با روش حداقل واریانس وارد (Ward) براي جمعیتهاي زنبور عسل با به کار بردن صفات کیفی: جمعیتهاي گروه A مربوط به نژاد ایتالیایی، گروه B مربوط به نژاد هیبرید میدنایت، گروه C مربوط به نژاد ایرانی و گروه D مربوط به هیبریدهاي میدنایت و استارلاین است.

۴۶۵

مجله پژوهشهاي سلولی و مولکولی (مجله زیست شناسی ایران) جلد ۲۶، شماره ۴، ۱۳۹۲

شکل -۲ نمودار درختی حاصل از تجزیه خوشهاي با روش حداقل واریانس وارد (Ward) براي جمعیتهاي زنبور عسل با بکار بردن صفات کمی:

گروههاي A وG وD مربوط به اقلیم نیمه خشک و گروههاي B و F مربوط به اقلیم نیمه مرطوب و گروه هاي G و C مربوط به اقلیم نیمه خشک و نیمه مرطوب است.

گروه بندي جمعیتها با استفاده از صفات کمی نیز به طور جداگانه انجام شد (شکل .(۲ در این گروهبندي نژادها به خوبی از هم تفکیک نشدهاند. بنابراین، نمیتوان تنها با استفاده از صفات کمی، جمعیتهاي مزبور را از هم مجزا کرد. در حالی که تفکیک جمعیتها بیشتر با شرایط اقلیمی آنها مطابقت داشت. در این نمودار جمعیتهاي مربوط به اقلیمهاي نیمه خشک و نیمه مرطوب در گروههاي جداگانهاي قرار گرفتند.

در گروهبندي جمعیتها و نژادها با ترکیب دادههاي کمی

(تومنتوم، رنگ نیم حلقه ها و وضعیت زاویه دیسکوئیدال)و دادههاي کیفی ( طول بال جلویی، شاخص کوبیتال، طول خرطوم، طول و زاویه رگبالها)، جمعیتها تا حدود زیادي از هم تفکیک گردیدند (شکل .(۳ بطوريکه مشاهده میگردد، نژادهاي ایرانی و ایتالیایی در این نمودار کاملاً از هم مجزا شدهاند. اما نژادهاي میدنایت و استارلاین همانند نمودار ردهبندي جمعیتها با استفاده از صفات کیفی به طور کامل از هم مجزا نشدند. همچنین گروهبندي جمعیتها بر اساس شرایط اقلیمی تا حدودي منطبق با گروه بندي جمعیتها بر اساس دادههاي کیفی و کمی بود.

جهت بررسی تنوع ژنتیکی از دو جایگاه ریزماهواره نیز استفاده گردید. آغازگر AM2 پلی مورفیسم و تنوع نواري

قابل توجهی نشان داد. این آغازگر چهار آلل در چهار جایگاه ژنی تولید کرد که هر چهار آلل چند شکل بودند.
آغازگر A88 دو نوار در دو لوکوس نشان داد که هر دو نوار مونومورف بودند. براي تعیین تعادل هاردي- واینبرگ از آزمون کاي اسکوئر براي یک جایگاه ژنی استفاده شد.
براساس این روش جمعیت ایتالیایی براي جایگاه ژنی

AM2در سطح ۰/۰۵ از تعادل انحراف نشان دادند ۰/۰۵)

. (P ≤ نتایج حاصل از این تحقیق نشان داد که با استفاده از این آغازگر، میزان هتروزیگوسیتی آللها تا حدودي متفاوت است که امري کاملاً طبیعی است. مقادیر هتروزیگوسیتی مشاهده شده (Ho) و هتروزیگوسیتی مورد انتظار (He) در هر جایگاه ژنی و براي هر جمعیت با استفاده از شاخص نی (Nei) محاسبه شد